HowTo

HowTo for MFEprimer 2.0

In the 1.x version, we have several examples to show the ability of MFEprimer, users may need to read these examples first.

Another classic application is that we have used MFEprimer to evaluate the primers used in C. elegans RNAi (Ahringer) library. Users may need to read this paper to get to know how to judge the primer's quality based on the MFEprimer result.

Here, I use an example to illustrate how to understand the MFEprimer-2.0 results. In other words, this document will help the user on how to evaluate the specificity of PCR primers based on the MFEprimer-2.0 results.

Background and primer design

Nnat (GeneID:18111) is a nervous system development related gene of mouse. It may participate in the maintenance of segment identity in the hindbrain and pituitary development, and strongly expressed in the major part of the central and peripheral nervous system. Alternative splicing generates two Nnat isotypes. The alpha-form (Nnatα) is encoded by three exons, whereas the beta-form (Nnatβ) is encoded by the first and third. Suppose we want to design a pair of primers to distinguish the two variants by size difference. We use VizPrimer to design the primer, as shown in Fig. 1. The primer sequences are: forward primer = GACCAGTAGACCTCGGCGAA, reverse primer = ACCTTGGCAAGTGCTCCTCT. One of the amplicon size is 341 bp (NM_180960.2) and another is longer than 341 bp (NM_010923.2).

Fig. 1 Design a pair of primers to distinguish two variants by size difference in VizPrimer

Primer specificity evaluation

Firstly, we choose the “Mouse – RefSeq mRNA & Genomic DNA” database as the background DNA/RNA to check the specificity of the PCR primers. Secondly, input the primer sequence in the box (5'-->3'). Other parameters use the default values (Fig. 2). Then click “Run”.

Fig. 2 Choose the database and enter the primers in MFEprimer-2.0

Now, we get the evaluation results by MFEprimer-2.0. From Fig. 3, we can see that, there are 344 potential amplicons. This is a huge number. Does it mean the primers are bad? Maybe or may not be. It needs further analysis.

1. Find the target amplicon. As expected, we find the 351 bp for NM_180960.2 (record 3) and the longer size 432 bp for NM_010923.2 (record 2). These two amplicons are target amplicons. If we can’t find the target amplicons, the PCR primer design failed.
2. Filter the non-specific amplicons which are probably not amplified in real PCR experiment. Except the target amplicons, the left amplicons (342 totally) are non-specific amplicons. But most of them are probably not amplified in real PCR experiment. This can be predicted by the Tm values (or ΔG). Non-specific amplicons which have Tm values close to the target amplicons are probably can be amplified. So how close should it be? In practice, we use a cutoff value of 10°C to filter the non-specific amplicons. In this example, the target Tm values are (61.9 and 62.0), so any amplicons which have Tm values higher than 61.9 – 10 = 51.9 and 62.0 – 10 = 52.0 are dangerous amplicons. Filtered by this step, we get only one non-specific amplicon: record 1 (Actually, this non-specific amplicon is the genome fragment of the gene Nnat). Usually, after this step, only a few of non-specific amplicons are left and we can check these amplicon manually.
3. Do the non-specific amplicons affect the PCR results? It depends on following factors.

• Genome contamination. In this example, the left non-specific amplicon (record 1) is a genome amplicon (NC means a genome record based on NCBI, see http://www.ncbi.nlm.nih.gov/RefSeq/key.html for more information) with size 1632 bp. If the sample doesn’t have any DNA fragments, this amplicon can’t be amplified.
• PCR results identified by agarose gel electrophoresis. If the PCR results were identified by agarose gel electrophoresis, the amplicon size is the key factor. In this example, the non-specific amplicon has size of 1632 bp, which is much longer than the target size (both for 351 and 432 bp). So it’s easy to distinguish the non-specific amplicon from the electrophoresis result.
• PCR results identified by probe hybridization. If the PCR results were identified by probe hybridization, the sequence similarity between the target amplicon and the non-specific amplicons is the key factor. If they have high similarity, the primers are bad because the probe can bind to the non-specific amplicons. Otherwise, it’s OK. In example, the non-specific amplicon is the genome fragment of the gene. So it’s dangerous if we identified the PCR results by probe hybridization in this example when the sample was contaminated by the genome DNA (Fig. 4).

1. Evaluation result for this example. In this example, the result was identified by agarose gel electrophoresis and we set the annealing temperature to 60°C. So we believe that the probably non-specific amplicon (record 1 with 1632 bp) wouldn’t affect the electrophoresis result and other amplification reactions wouldn’t happen.

Fig. 3 Evaluation results indicates there are a lot of potential non-specific amplicons

Fig. 4 Multiple alignment results of the target and non-specific amplicons

Experimental validation

Fig. 5 indicates that our primers are good and very specific.

Fig. 5 Experiment results shows that the primers are specific