-
Notifications
You must be signed in to change notification settings - Fork 17
Fasta Format
Wubin Qu edited this page May 23, 2017
·
3 revisions
A sequence in FASTA format begins with a single-line description, followed by lines of sequence data. The description line is distinguished from the sequence data by a greater-than (">") symbol in the first column. The word following the ">" symbol is the identifier (unique required) of the sequence, and the rest of the line is the description (optional). There should be no space between the ">" and the first letter of the identifier. It is recommended that all lines of text be shorter than 80 characters. The sequence ends if another line starting with a ">" appears; this indicates the start of another sequence.
>PrimerName1 This is description, can be any words CTGTTTAAGACTCACCCTGAGAC >PrimerName2 Primer name should be unique, duplication name not allowed GGTGCAACCATGCTTCTTCA >PrimerName3 Primer name just like everyone's ID CTGCCGAGATCCAGCCTCTA >PrimerName4 GCATCTGCTCCAAAGTCCCC