This python package provides routines for the extraction of degenerate sites from sequences and alignments. The latter is particularly useful for estimations of rates of neutral evolution.
This code uses biopython and scikit-bio internally. In order to installl via pip, numpy has to be installed.
Simply clone this repo:
git clone https://github.com/nickmachnik/codon-degeneracy.git [TARGET DIR]
and then install via pip
pip install [TARGET DIR]
or install directly from PyPI (this won't include unreleased changes as specified in the changelog):
pip install codon-degeneracy
Test the cloned package:
cd [TARGET DIR]
python -m unittest
There are more useful and well documented functions under the hood than shown here, which I enourage to explore by browsing the code.
One of the main features of the package is the counting of neutral substitutions at four fold degenerate sites.
This is best done with known orthologue pairs between species.
substitution_rate_at_ffds
provides that functionality and is easy to use like so:
from codon_degeneracy import substitution_rate_at_ffds as nsr
seq_a = (
"ATACCCATGGCCAACCTCCTACTCCTCATTGTACCCATTC"
"TAATCGCAATGGCATTCCTAATGCTTACCGAACGA")
seq_b = (
"ATGACCACAGTAAATCTCCTACTTATAATCATACCCACAT"
"TAGCCGCCATAGCATTTCTCACACTCGTTGAACGA")
(number_of_substitutions, number_of_sites), (orf_a, orf_b) = nsr(
# the input sequences
seq_a,
seq_b,
# NCBI codon table names as used in Bio.Data.CodonTable
"Vertebrate Mitochondrial",
"Vertebrate Mitochondrial")
The ORFs returned are there for sanity checks. The default behaviour is to select the first ATG codon as start.
NOTE: The numbers of neutral substitutions per site reported by this function are merely a lower bound, as they do not include the possibility of multiple substitutions per site.
In certain situations, it may be useful to differentiate between four fold degenerate sites
that could potentially exist in a CpG context and could therefore exhibit an elevated
mutation rate and those that do not. substitutions_per_ffds_by_cpg_context
provides that
functionality.
It differentiates between four CpG contexts. Sites that are:
- preceded by C and not followed by G (nonCpG)
- preceded by C but not followed by G (postC)
- followed by G but not preceded by C (preG)
- preceded by C and followed by G (postCpreG)
Note: the number of sites considered here may be substantially lower than in
substitutions_per_ffds
, as this function requires the sites preceeding and following site of a four fold degenerate site to be identical in the two aligned sequences.
The function can be used in exactly the same that is shown for substitutions_per_ffds
above.
MIT license (LICENSE or https://opensource.org/licenses/MIT)