Merge pull request #86 from adrientaudiere/dev

v0.7.8

DESCRIPTION

@@ -1,7 +1,7 @@
 Package: MiscMetabar
 Type: Package
 Title: Miscellaneous Functions for Metabarcoding Analysis
-Version: 0.7.7
+Version: 0.7.8
 Authors@R: person("Adrien", "Taudière", email = "adrien.taudiere@zaclys.net",
   role = c("aut", "cre", "cph"), comment = c(ORCID = "0000-0003-1088-1182"))
 Description: The MiscMetabar package aims to facilitate the description, transformation, exploration, and reproducibility of metabarcoding analysis. Mainly build on the top of phyloseq, dada2 R packages. MiscMetabar help to build reproducible and robust bioinformatics pipelines in R. MiscMetabar make ecological analysis of alpha and beta-diversity simple and powerful by integrating a large number of analysis, some of them from other R packages.  

NEWS.md

@@ -8,7 +8,8 @@
 - Add function `cutadapt_remove_primers()` to remove primers using [cutadapt](https://github.com/marcelm/cutadapt/)
 - Add internal functions `is_swarm_installed()`, `is_cutadapt_installed()`, `is_vsearch_installed()` and `is_falco_installed()` to test for the availability of external software in order to run examples and test from testthat.
 
-- Submit to CRAN and change code to comply with their rules (patch 0.7.1 to 0.7.4)
+- Submit to CRAN and change code to comply with their rules (patch 0.7.1 to 0.7.8)
+- Numerous examples and tests are skipped on CRAN because it spends to much time to run. Rules vignettes is updated to details the strategy for this.
 
 
 ## BREAKING CHANGES

R/dada_phyloseq.R

@@ -1003,6 +1003,7 @@ read_pq <- function(path = NULL,
 #' @param clean_pq (logical) if true, empty samples and empty ASV are discarded
 #'   before clustering.
 #' @param keep_temporary_files (logical, default: FALSE) Do we keep temporary files
+#' @param ... Others args for function [lulu()]
 #' @return a list of for object
 #' - "new_physeq": The new phyloseq object (class physeq)
 #' - "discrepancy_vector": A vector of discrepancy showing for each taxonomic
@@ -1037,7 +1038,8 @@ lulu_pq <- function(physeq,
                     vsearchpath = "vsearch",
                     verbose = FALSE,
                     clean_pq = FALSE,
-                    keep_temporary_files = FALSE) {
+                    keep_temporary_files = FALSE,
+                    ...) {
   verify_pq(physeq)
   if (is.null(physeq@refseq)) {
     stop("The phyloseq object do not contain a @refseq slot")
@@ -1067,7 +1069,7 @@ lulu_pq <- function(physeq,
 
   message("Lulu algorithm")
   res_lulu <-
-    lulu(data.frame(t(physeq@otu_table)), match_list)
+    lulu(data.frame(t(physeq@otu_table), ...), match_list)
 
   if (!keep_temporary_files) {
     if (file.exists("temp.fasta")) {

R/vsearch.R

@@ -19,12 +19,11 @@
 #' @examplesIf MiscMetabar:::is_vsearch_installed()
 #' \donttest{
 #' file_dna <- tempfile("dna.fa")
-#' seqinr::write.fasta("GCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTTCAACCCTCAAGCCCCTTATTGCTTGGTGTTGGGAGTTTAGCTGGCTTTATAGCGGTTAACTCCCTAAATATACTGGCG",
-#'   nbchar = 200,
+#' seqinr::write.fasta("GCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTTCAACC",
 #'   file = file_dna, names = "seq1"
 #' )
 #'
-#' res <- vs_search_global(data_fungi, file_dna)
+#' res <- vs_search_global(data_fungi, path_to_fasta = file_dna)
 #' unlink(file_dna)
 #'
 #' res[res$identity != "*", ]
@@ -58,7 +57,7 @@ vs_search_global <- function(physeq,
   }
   if (!is.null(seq2search)) {
     if (inherits(seq2search, "character")) {
-      seq2search <- Biostrings::readDNAStringSet(seq2search)
+      seq2search <- Biostrings::DNAStringSet(seq2search)
     }
     Biostrings::writeXStringSet(seq2search, paste0(tempdir(), "seq2search.fasta"))
     seq2search <- paste0(tempdir(), "seq2search.fasta")

tests/testthat/test_deseq2_edgeR.R

@@ -51,6 +51,7 @@ test_that("plot_deseq2_pq works with results on GP dataset", {
 
   expect_error(plot_deseq2_pq(res, c("SampleType", "Soil", "Skyp"), tax_table = GP@tax_table, color_tax = "Kingdom"))
   expect_error(plot_deseq2_pq(res, c("SampleType", "Soil", "Skin"), color_tax = "Class"))
+  expect_error(plot_deseq2_pq(data_fungi_mini@otu_table, c("SampleType", "Soil", "Skyp"), tax_table = GP@tax_table, color_tax = "Kingdom"))
   expect_message(plot_deseq2_pq(res, c("SampleType", "Soil", "Skin"), tax_table = GP@tax_table, color_tax = "Class", select_taxa = "522457"))
   expect_message(plot_deseq2_pq(res, c("SampleType", "Soil", "Skin"), tax_table = GP@tax_table, color_tax = "Class", select_taxa = c("522457", "271582")))
   expect_message(suppressWarnings(plot_deseq2_pq(res, c("SampleType", "Soil", "Skin"), tax_table = GP@tax_table, select_taxa = c("522457", "200359"))))
@@ -61,7 +62,7 @@ test_that("plot_deseq2_pq works with GP dataset", {
   skip_on_cran()
   expect_message(suppressWarnings(plot_deseq2_pq(GP, c("SampleType", "Soil", "Skin"), color_tax = "Class", select_taxa = c("522457", "271582", "200359"))))
   expect_message(suppressWarnings(plot_deseq2_pq(GP, c("SampleType", "Soil", "Skin"), taxolev = "Class", verbose = TRUE)))
-  expect_message(suppressWarnings(plot_deseq2_pq(GP, c("SampleType", "Soil", "Skin"), pval = 0.1)))
+  expect_message(suppressWarnings(plot_deseq2_pq(GP, c("SampleType", "Soil", "Skin"), pval = 0.1, tax_depth = "Family")))
 })
 
 

tests/testthat/test_figures_beta_div.R

@@ -263,7 +263,10 @@ test_that("upset_pq works with data_fungi dataset", {
   expect_s3_class(upset_pq(data_fungi_mini, "Time"), "ggplot")
   expect_s3_class(upset_pq(data_fungi_mini, "Time", min_nb_seq = 10), "ggplot")
   expect_s3_class(
-    upset_pq(data_fungi_mini, "Time", numeric_fonction = mean),
+    upset_pq(data_fungi_mini, "Time",
+      numeric_fonction = mean,
+      na_remove = FALSE
+    ),
     "ggplot"
   )
 
@@ -422,4 +425,4 @@ test_that("multipatt_pq works with data_fungi_mini dataset", {
 
   expect_s3_class(res_time$ss_tab, "data.frame")
   expect_equal(dim(res_time$res), c(12, 15))
-})
+})

tests/testthat/test_figures_taxo.R

@@ -78,7 +78,8 @@ test_that("plot_tax_pq works with data_fungi dataset", {
         data_fungi_mini,
         "Time",
         merge_sample_by = "Time",
-        taxa_fill = "Class"
+        taxa_fill = "Class",
+        nb_print_value = 2
       )
   ))
   expect_s3_class(pt, "ggplot")
@@ -206,7 +207,7 @@ test_that("multitax_bar_pq works with GlobalPatterns dataset", {
   )
   skip_on_cran()
   expect_s3_class(
-    multitax_bar_pq(GP_archae, "Phylum", "Class", "Order"),
+    multitax_bar_pq(GP_archae, "Phylum", "Class", "Order", nb_seq = FALSE),
     "ggplot"
   )
   expect_s3_class(
@@ -331,6 +332,16 @@ test_that("treemap_pq work with data_fungi_sp_known dataset", {
     ),
     "ggplot"
   )
+  expect_s3_class(
+    treemap_pq(
+      data_fungi_mini,
+      "Order",
+      "Class",
+      nb_seq = FALSE,
+      log10trans = TRUE
+    ),
+    "ggplot"
+  )
 })
 
 test_that("tax_bar_pq work with data_fungi dataset", {

tests/testthat/test_phyloseq_class.R

@@ -21,18 +21,14 @@ test_that("asv2otu works fine with Clusterize method", {
   expect_error(asv2otu(data_fungi_mini, dna_seq = sequences_ex))
 })
 
-
-
-
-suppressWarnings(vsearch_error_or_not <- try(system("vsearch 2>&1", intern = TRUE), silent = TRUE))
-
-if (class(vsearch_error_or_not) == "try-error") {
+if (!is_vsearch_installed()) {
   message("lulu_pq() can't be tested when vsearch is not installed")
 } else {
   test_that("lulu_pq works fine", {
     expect_s4_class(lulu_pq(data_fungi)$new_physeq, "phyloseq")
     expect_error(lulu_pq(enterotype)$new_physeq)
     expect_s4_class(lulu_pq(data_fungi_sp_known, clean_pq = TRUE, verbose = TRUE)$new_physeq, "phyloseq")
+    expect_error(lulu_pq(data_fungi_sp_known, minimum_ratio_type = "avg")$new_physeq)
   })
 }
 

tests/testthat/test_targets.R

@@ -171,8 +171,9 @@ test_that("sample_data_with_new_names function works fine", {
   )
   expect_silent(filt_fastq_fw <- filter_trim(testFastqs_fw, output_fw = tempdir()))
   expect_equal(length(derepFastq(filt_fastq_fw[1])), 2)
-  expect_silent(filt_fastq_pe <- filter_trim(testFastqs_fw,
-    testFastqs_rev,
+  expect_silent(filt_fastq_pe <- filter_trim(
+    fw = testFastqs_fw,
+    rev = testFastqs_rev,
     output_fw = tempdir("fw"),
     output_rev = tempdir("rev")
   ))

vignettes/articles/Rules.Rmd

@@ -23,7 +23,34 @@ vignette: >
 - **Maturing**: Some tests and/or analyses make stronger these functions
 - **Stable**: Good level of confidence
 
+## Tests and examples
 
+### Special cases of external softwares
+
+Some examples and test required the installation of external softwares. I used MiscMetabar internal functions (such as [is_vsearch_installed()]) to conditionnaly test (`if(is_vsearch_installed()){...test...}`) and run examples `#' @examplesIf is_vsearch_installed()`.
+
+### Special case of CRAN
+
+I use `\donttest{}` for some long examples (in roxygen documentation) and `testthat::skip_on_cran()` in long test.
+
+### Special case of windows
+
+Some tests and examples are not tested on windows. I used `testthat::skip_on_os("windows")` inside test and `#' @examplesIf tolower(Sys.info()[["sysname"]]) != "windows"` in examples (roxygen documentation). Here is a list of functions with some limitations or not working at all on windows OS: 
+
+- [build_phytree_pq()]
+- [count_seq()]
+- [cutadapt_remove_primers()]
+- [krona()]
+- [merge_krona()]
+- [multipatt_pq()]
+- [plot_tsne_pq()]
+- [rotl_pq()]
+- [save_pq()]
+- [tax_datatable()]
+- [track_wkflow()]
+- [track_wkflow_samples()] 
+- [tsne_pq()]
+- [venn_pq()]
 
 # Session information