This is a fork of BayesPairing 2 to be used within the context of a larger Bioionformatics pipeline. For info on BayesPairing, please click here.
Changes to the official branch of BayesPairing (continually updated)
- BayesPairing previously operated by use of absolute imports/references to file paths. These were switched to relative imports in-order to allow it to fit within the project architecture.
- A flask layer that allows BayesPairing to be called from an endpoint. This includes endpoints for file input & string input as well as another to retrieve representative graphs from a module database.
- BayesPairing has also been dockerized, and a dockerfile is provided.
- Three additional classes are created within core/src/pipeline.
- pipeline_bp: A modification of run_fasta from parse_sequences that does not save output to files
- pipeline_chefschoice: A modification of key methods from chefs_choice that handle SVG generation
- chefs_assistant: a new class that handles virtually all heavy lifting and processing of the BP service
- Testing! Located within the tests directory! Because BP results are non-deterministic, these mainly validate that results are successful or a failure and whether keys exist, not the exact contents of a specific result.
- TravisCI will automatically run tests after each commit
The command line program remains functional, but must now be run from the root directory instead of src. Here is a sample run:
python3 -m core.src.parse_sequences -seq "UUUUUUAAGGAAGAUCUGGCCUUCCCACAAGGGAAGGCCAAAGAAUUUCCUU" -samplesize 1000 -t 4 -d ALL
Note that you must first set-up and activate the Anaconda environment (requirements provided in environment.yml).
This package includes tools for:
- Identifying RNA 3D modules in a sequence
- Creating your own BayesPairing models
- RNA 3D module plotting
- Searching for modules in many sequences separately (fasta format)
- Searching for modules in alignments (stockholm format)
- Identifying modules in sequences with known secondary structure.
The article is available on biorxiv: https://www.biorxiv.org/content/10.1101/834762v1.abstract
- Python 3.6+
- Docker
- Flask
- Gunicorn
- Networkx 2.1+
- BioPython
- matplotlib
- weblogo
- wrapt
- anytree
- pgmpy (included)
- RNAlib (viennaRNA)
- LaTeX (optional)
For inquiries on BayesPairing specifically, please contact:
Roman Sarrazin-Gendron roman.sarrazingendron@mail.mcgill.ca
For inquiries regarding the overall pipeline as well as top level code including the Flask/Docker layer, please open an issue.