Skip to content

HosnaJabbari/Iterative-HFold

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

HFold Iterative

Description:

Software implementation of Iterative HFold.
Iterative HFold is an algorithm for predicting the pseudoknotted secondary structures of RNA using relaxed Hierarchical Folding.

Paper: Jabbari, H., Condon, A. A fast and robust iterative algorithm for prediction of RNA pseudoknotted secondary structures. BMC Bioinformatics 15, 147 (2014). https://doi.org/10.1186/1471-2105-15-147 (https://bmcbioinformatics.biomedcentral.com/articles/10.1186/1471-2105-15-147)

On the dataset tested in this paper, Iterative HFold generally has better accuracy that its predecessor, HFold.

Supported OS:

Linux, macOS

Conda Package:

conda install -c uvic-cobra iterative-hfold

Works for Linux and macOS

Source code Installation:

Requirements: A compiler that supports C++11 standard (tested with g++ version 4.9.0 or higher), Pthreads, and CMake version 3.1 or greater.

CMake version 3.1 or greater must be installed in a way that HFold can find it.
To test if your Mac or Linux system already has CMake, you can type into a terminal:

cmake --version

If it does not print a cmake version greater than or equal to 3.1, you will have to install CMake depending on your operating system.

Mac:

Easiest way is to install homebrew and use that to install CMake.
To do so, run the following from a terminal to install homebrew:  

/usr/bin/ruby -e "$(curl -fsSL https://github.com/raw/Homebrew/install/master/install)"   

When that finishes, run the following from a terminal to install CMake.    

brew install cmake   

Linux:

Run from a terminal

wget http://www.cmake.org/files/v3.8/cmake-3.8.2.tar.gz
tar xzf cmake-3.8.2.tar.gz
cd cmake-3.8.2
./configure
make
make install

Linux instructions source

Steps for installation

  1. Download the repository and extract the files onto your system.
  2. From a command line in the root directory (where this README.md is) run
cmake -H. -Bbuild
cmake --build build

If you need to specify a specific compiler, such as g++, you can instead run something like

cmake -H. -Bbuild -DCMAKE_CXX_COMPILER=g++
cmake --build build

This can be useful if you are getting errors about your compiler not having C++11 features.

After installing you can move the executables wherever you wish, but you should not delete or move the simfold folder, or you must recompile the executables. If you move the folders and wish to recompile, you should first delete the created "build" folder before recompiling.

How to use:

Arguments:
    HFold_iterative:
        -r <structure>
        -i </path/to/file>
        -o </path/to/file>
        -v
        -V
        -n <number of outputs>
        -p

    Remarks:
        make sure the <arguments> are enclosed in "", for example -r "..().." instead of -r ..()..
        The sequence does not need to be enclosed and can be given before or after the other arguments
        if no structure is provided through -r , the input structure will be the hotspot with the lowest free energy
        if -i is provided with just a file name without a path, it is assuming the file is in the diretory where the executable is called
        if -o is provided with just a file name without a path, the output file will be generated in the diretory where the executable is called
        if -v is provided, a verbose output will be given (method used is outputted)
        if -V is provided, the version is given
        if -n is provided with a number, it will modify the number of hotspots looked and outputs given (the base is 1)
        if -p is provided, it will change the output to pseudoknot-free


Sequence requirements:
    containing only characters GCAUT

Structure requirements:
    -pseudoknot free
    -containing only characters ._(){}[]
    Remarks:
        Restricted structure symbols:
            () restricted base pair
            _ no restriction

Input file requirements:
        Line1: Name (optional, but must be fasta format; ignored in final input)
        Line2: Sequence (required)
        Line3: Structure (optional)
    sample:
        >Srp_005
        GCAACGAUGACAUACAUCGCUAGUCGACGC
        (____________________________)

Example:

assume you are in the directory where the HFold_iterative executable is loacted
./HFold_iterative -i "/home/username/Desktop/myinputfile.txt"
./HFold_iterative -i "/home/username/Desktop/myinputfile.txt" -o "outputfile.txt"
./HFold_iterative -i "/home/username/Desktop/myinputfile.txt" -o "/home/username/Desktop/some_folder/outputfile.txt"
./HFold_iterative GCAACGAUGACAUACAUCGCUAGUCGACGC -r "(____________________________)"
./HFold_iterative GCAACGAUGACAUACAUCGCUAGUCGACGC -r "(____________________________)" -o "outputfile.txt"
./HFold_iterative GCAACGAUGACAUACAUCGCUAGUCGACGC
./HFold_iterative GCAACGAUGACAUACAUCGCUAGUCGACGC -n 10
./HFold_iterative GCAACGAUGACAUACAUCGCUAGUCGACGC -p

Exit code:

0       success
1	    invalid argument error 
3	    thread error
4       i/o error
5       pipe error
6       positive energy error
error code with special meaning: http://tldp.org/LDP/abs/html/exitcodes.html
2	    Misuse of shell builtins (according to Bash documentation)
126	    Command invoked cannot execute
127	    "command not found"
128	    Invalid argument to exit	
128+n	Fatal error signal "n"
130	    Script terminated by Control-C
255	    Exit status out of range (range is 0-255)