cutadapt: error: cutadapt not able to trim the desired adapto

[faizee-ali]

I have Illumina novaseq, pair ended reads and I want to trim the non-internal adaptors from both ends. The adaptors I used for library praparation are NEB next adaptors for illumina. So I executed the following command:-

cutadapt -a AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTX -G XAGATCGGAAGAGCACACGTCTGAACTCCAGTCA --pair-filter=both --minimum-length 1 --cores=8 -o out-read1.fastq -p out-read2.fastq in-read1.fastq.gz in-read2.fastq.gz -o out-10936-R1.fastq

Here, the paths to the reads are correct and I am getting a valid output of trimmed reads. But upon inpection with FASTQC, I can see adaptor contamination still present - as seen in the attacjed fastqc report, and a poly G tail is also present

Is there something I am missing in the command? Are the adaptor placements correct?

When reporting an issue, please include this information:

• Cutadapt and Python version - 4.8 :
• How you installed the tool (conda or pip, for example) : intalled with pip
• Which command-line parameters you used : given above

If you report unexpected trimming behavior, this would also be helpful:

• An example input read (or read pair) : 3'ADAPTERXREAD
• The output that cutadapt produces : 3'ADAPTERXREAD
• The output that you would have expected : 3'READ

[faizee-ali]

this is the QC of the raw read, cutadapt has not effectively trimmed the adaptor sequences

[rhpvorderman]

Hi, there are several things:

• Putting X in the adapter sequence makes it non-internal. This is not how Illumina sequencing technology works. The adapters will not just appear at the end. It will be AGATGAT|ADAPTER|SOMETHINGSOMETHING|GGGGGGGGGGGGG. If the insert size is small enough, and your sample seems to have a very small insert size.
• The -G flag should probably be a -A flag for paired-end trimming.
• I see you are outputting to .fastq that is taking so much space. Try .fastq.gz outputs with the -Z flag if speed is a concern.

The command would become:

cutadapt -Z -a AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -A AGATCGGAAGAGCACACGTCTGAACTCCAGTCA --pair-filter=both --minimum-length 1 --cores=8 -o out-read1.fastq.gz -p out-read2.fastq.gz in-read1.fastq.gz in-read2.fastq.gz -o out-10936-R1.fastq

Does that help you?

[faizee-ali]

Yes it did thanks now I see much better adaptor removal!